Please wait a minute...
Journal of Arid Land
Journal of Arid Land  2025, Vol. 17 Issue (4): 538-559    DOI: 10.1007/s40333-025-0011-0    
Research article     
Diversification of flavonoid accumulation among ecotypes of Agriophyllum squarrosum (L.) Moq. in response to drought stress
ZHAO Pengshu1,2,3, YAN Xia1,4,*(), QIAN Chaoju1,2, MA Guorong5, FANG Tingzhou1,2, YIN Xiaoyue1,2, ZHOU Shanshan1,2, LIAO Yuqiu1,2,3, SHI Liang1,2,3, FAN Xingke1,2, Awuku IBRAHIM1,2, MA Xiaofei1,2
1Key Laboratory of Ecological Safety and Sustainable Development in Arid Lands, Northwest Institute of Eco-Environment and Resources, Chinese Academy of Sciences, Lanzhou 730000, China
2Key Laboratory of Stress Physiology and Ecology in Cold and Arid Regions of Gansu Province, Northwest Institute of Eco-Environment and Resources, Chinese Academy of Sciences, Lanzhou 730000, China
3University of Chinese Academy of Sciences, Beijing 100049, China
4Key Laboratory of Inland River Ecohydrology, Cold and Arid Regions Environmental and Engineering Research, Northwest Institute of Eco-Environment and Resources, Chinese Academy of Sciences, Lanzhou 730000, China
5Gulang County Sand Prevention and Control Technology Promotion Center, Wuwei 733100, China
Download: HTML     PDF(2873KB)
Export: BibTeX | EndNote (RIS)      

Abstract  

Agriophyllum squarrosum (L.) Moq., commonly known as sandrice, is an annual medicinal plant prevalent in the dunes across China's deserts. A garden trial revealed that flavonoid content varies among sandrice ecotypes due to long-term local adaptation to water variability. To investigate how sandrice responds to drought stress through the molecular metabolic regulation of flavonoids, we employed transcriptomic and metabolomic analyses during a 9-d ambient drought stress, examining three ecotypes along a precipitation gradient. The three ecotypes located in Dengkou (DK) County, Dulan (DL) County, and Aerxiang (AEX) village of northern China, which had 137, 263, and 485 mm precipitation, respectively. Soil moisture content was 4.04% after drought stress, causing seedlings of the three sandrice ecotypes to display collapsed structures, yellowing leaves, wilting, and curling. Among these, DL exhibited superior drought tolerance, in which plant height increase (PHI) and leaf area (LA) were significantly higher than those of DK and AEX. Flavonoid-targeted metabolomics identified that rutin, isoquercitrin, and astragalin constituted over 95.00% of the 15 flavonoid metabolites detected. A total of 12 differentially accumulated flavonoids (DAFs) were found, with rutin being the most abundant (1231.57-2859.34 ng/100 mg fresh weight (FW)), showing a gradual increase along the precipitation gradient. Transcriptomic analysis revealed 14 common differentially expressed genes (DEGs) associated with flavonoid synthesis among the three ecotypes. Integrative analysis of DEGs and DAFs indicated that sandrice adapts to drought stress by activating different flavonoid synthesis pathways. In DK, the dihydrokaempferol-dihydroquercetin pathway, regulated by flavonoid 3'-monooxygenase (CYP75B1), likely enhances drought adaptation. In AEX, transcriptional repression by O-methylatransferase (OMT) shifts the metabolic flux from the quercetin-isorhamnetin pathway to the quercetin-isoquercetin-rutin pathway in response to drought. DL, the most drought- tolerant ecotype, appears to activate the naringenin-apigenin-luteolin route and employs a unique flavonoid accumulation pattern in response to drought stress. Our data reveal that flavonoid synthesis in sandrice is fine-tuned among ecotypes to cope with drought, offering valuable germplasm resources and evaluation methods for sandrice acclimation and providing insights into drought response in non-model plants.

Key words： drought tolerance      ecotype      flavonoid      medicinal plant      rutin     
Received: 26 August 2024      Published: 30 April 2025
Corresponding Authors: *YAN Xia (E-mail: yanxia@lzb.ac.cn)
Service
E-mail this article
Add to my bookshelf
Add to citation manager
E-mail Alert
RSS
Articles by authors
ZHAO Pengshu
YAN Xia
QIAN Chaoju
MA Guorong
FANG Tingzhou
YIN Xiaoyue
ZHOU Shanshan
LIAO Yuqiu
SHI Liang
FAN Xingke
Awuku IBRAHIM
MA Xiaofei
Cite this article:

ZHAO Pengshu, YAN Xia, QIAN Chaoju, MA Guorong, FANG Tingzhou, YIN Xiaoyue, ZHOU Shanshan, LIAO Yuqiu, SHI Liang, FAN Xingke, Awuku IBRAHIM, MA Xiaofei. Diversification of flavonoid accumulation among ecotypes of Agriophyllum squarrosum (L.) Moq. in response to drought stress. Journal of Arid Land, 2025, 17(4): 538-559.

URL:

http://jal.xjegi.com/10.1007/s40333-025-0011-0     OR     http://jal.xjegi.com/Y2025/V17/I4/538

Ecotype Collection
site		 Altitude
(m)		 Latitude Longitude Mean annual
precipitation (mm)		 Annual mean temperature (°C) Phenotypic characteristics
DK Dengkou 1050 40°22°42"N 106°59°37"E 137 8.31 Small seed size and short broad leaf
DL Dulan 3130 36°25°25"N 98°07°25"E 263 3.40 Seed wing, long broad thick leaf, and large leaf area
AEX Aerxiang 251 42°52°04"N 122°25°40"E 485 6.38 Large seed size and long thin leaf
Table 1 Native habitat environments and phenotypic characteristics of the three ecotypes
Gene name Gene No. Forward primer (5° to 3°) Reverse primer (5° to 3°) Primer melting temperature (°C) Product length
(bp)
UBC22 AsqAEX016065 AATGGAGCCCAGCACTTACA GCCTCATACTTTGGCCGATCA 57.00 133
PP2A AsqAEX007496 TCGCCCCTGTTTAGTGGAGT GTACGTCTTCTCTGCCGACT 58.00 122
3'GT AsqAEX018709 TAGCAAAGCTCTGGGCATCC GTGAGTCTATGGAGTCGCGG 58.00 90
CYP75B1 AsqAEX001259 CGGAGGTGCTAAAGAAGGCA GACTACAGGGTGCAAACGGA 58.00 137
ANR AsqAEX017402 ACTCCCAGCCCTAACTGCTA CTCCACCCCAGCTACTGTTG 58.00 132
CHS AsqAEX006531 GGGGTCAGCCCAAGTCTAAG TTGGTGAGTTGGTAGTCCGC 58.00 88
FLS AsqAEX017561 GACTGGGGCTGCAAGAAGAT ATCAGGGCAAGGACATGGTG 58.00 101
COMT5 AsqAEX006593 CTACAGAATCCGGATGCCCC CGACTGTGCGAACTGTTGTG 58.00 94
COMT1 AsqAEX003966 GCACATTTGCCAGCCAAGAA GGTCCTGATGGTGCAAGTGA 58.00 99
CHI AsqAEX010035 TCTGGAAGGCCATCGGAGTA AAAATAGAGTGGCCCGGTGG 58.00 103
Table S1 Primers for quantitative real-time PCR (qRT-PCR) analysis
Fig. 1 Effects of drought stress on the morphological traits and physiological indicators in DK (Dengkou County), DL (Dulan County), and AEX (Aerxiang Village) ecotypes. (a), phenotype of DK, DL, and AEX after drought stress and control treatments (CDK, CDL, and CAEX); (b), soil moisture content; (c), above-ground biomass (AGB); (d), plant height increase (PHI); (e), leaf area (LA); (f), stem diameter (STD); (g), basal branch length (BBL); (h), Fv'/Fm' value at vegetative stage; (i), leaf relative water content (RWC). DDK, DDL, and DAEX represented the drought stress treatments of DK, DL and AEX, respectively. Bars are standard errors. Within the same treatment (control or drought), different lowercase letters indicated significant difference at P<0.050 level. Asterisks on shoulder lines indicated statistically significant differences between control and drought of the same ecotype. *, P<0.050 level; **, P<0.010 level. The abbreviations are the same in the following figures and tables.
Compound name CDK DDK CDL DDL CAEX DAEX
(ng/100 mg fresh weight (FW))
Rutin 1231.57 1350.47 1668.45 1720.60 2495.48 2859.34
Isoquercitrin 1653.85 1442.55 1726.87 1461.72 1577.22 1593.38
Astragalin 818.28 714.61 741.53 519.81 650.12 722.03
Quercetin 12.48 14.44 10.68 7.91 17.55 26.85
Vitexin 12.06 26.72 14.93 21.38 4.28 10.27
Isorhamnetin 3.45 5.82 2.01 1.99 12.88 5.27
Dihydrokaempferol 1.16 1.93 2.12 5.13 2.78 3.49
Kaempferol 2.17 1.59 1.73 1.52 2.63 2.13
Dihydroquercetin 1.02 1.24 0.85 1.49 1.09 0.97
Luteolin 0.38 0.55 0.65 1.72 0.45 0.89
Naringenin 0.39 0.50 0.45 1.75 0.18 0.49
Apigenin 0.11 0.13 0.10 0.14 0.08 0.08
Catechin 0.41 0.13 0.07 0.11 0.16 0.07
Epicatechin 0.10 0.01 0.11 0.01 0.03 0.06
Naringenin chalcone 0.56 0.01 0.82 0.68 0.01 0.01
Total flavonoid 3737.99 3560.70 4171.37 3745.96 4764.94 5225.33
Table 2 Composition and average content of 15 flavonoids targeting metabolites
Fig. S1 Significant difference analysis of flavonoid-targeting metabolites in above-ground tissue of sandrice. (a), principal component analysis (PCA); (b-d), orthogonal partial least squares discriminant analysis (OPLS-DA). PC1 represents the first principal component, and PC2 represents the second principal component. t[1]P represents the predicted principal component score of the first principal component, showing the differences between sample groups, and t[1]O represents the orthogonal principal component score of the second principal component, showing the differences within sample groups.
Fig. 2 Flavonoid-targeting metabolites identified in above-ground tissue of sandrice. (a), percentage of flavonoid-targeting metabolome; (b), Venn of metabolite significance analysis; (c), hierarchical cluster heatmap analysis of metabolites.
Sample Raw data
(Gb)		 Clean data
(Gb)		 Q30 (%) Uniquely mapped (%) Total mapped reads (%) GC (%)
CDK1 7.09 6.68 91.05 93.16 96.25 44.78
CDK2 7.21 6.71 91.20 93.53 96.38 45.21
CDK3 7.61 7.08 90.87 93.21 96.11 45.09
DDK1 6.83 6.38 90.69 92.19 95.72 44.37
DDK2 6.91 6.47 90.55 92.23 95.68 44.25
DDK3 6.93 6.45 90.77 92.48 95.78 44.43
CDL1 7.01 6.63 91.91 93.40 96.22 45.28
CDL2 6.66 6.22 91.92 93.45 96.17 45.12
CDL3 7.41 6.95 91.04 93.06 95.89 44.68
DDL1 7.32 6.91 91.32 92.52 95.71 44.47
DDL2 7.63 7.19 91.21 92.57 95.87 44.37
DDL3 7.29 6.88 91.57 92.68 96.16 44.38
CAEX1 7.14 6.57 91.50 94.72 97.76 44.96
CAEX2 7.11 6.70 91.32 94.56 97.55 44.94
CAEX3 7.12 6.75 91.50 94.69 97.79 44.71
DAEX1 7.34 6.87 91.22 94.39 97.78 44.37
DAEX2 6.97 6.47 90.54 93.87 97.04 44.56
DAEX3 6.97 6.53 90.78 94.34 97.62 44.49
Table S2 Summary of the ribonucleic acid sequence (RNA-Seq) results of sandrice aboveground tissue
Fig. S2 PCA analysis showing the transcriptomes divergence
Fig. 3 Description of differentially expressed genes (DEGs) in transcriptome data of the three ecotypes of sandrice in response to drought. (a), number of DEGs; (b), Venn diagram showing overlap of DEGs in the three ecotypes; (c), heatmap analysis of 3177 DEGs in Figure 3b; (d), Kyoto encyclopedia of genes and genomes (KEGG) enrichment analysis bubble map. Dot size represents the number of distinct genes, and dot color reflects the q-value.
Fig. S3 Venn diagram showing overlap of up-regulated differentially expressed genes (DEGs) (a) and down-regulated DEGs (b) in the three ecotypes
Fig. S4 Kyoto encyclopedia of genes and genomes (KEGG) enrichment analysis bubble map in DL. AGE-RAGE, advanced glycation end products-receptor for advanced glycation end products.
Fig. 4 Cluster analysis and correlation analysis between DEGs and differentially accumulated flavonoids (DAFs). (a), genes related to flavonoid synthesis in 18 samples. LDOX, leucoanthocyanidin dioxygenase; F5H, cytochrome P450 84A1; 3'GT, anthocyanin 3'-O-beta-glucosyltransferase; AOMT, flavonoid 3',5'-methyltransferase; CYP75B1, flavonoid 3'-monooxygenase; FOMT, flavonoid 3'-O-methyltransferase; CHI, chalcone isomerase; CHS, chalcone synthase; COMT, caffeic acid 3-O-methyltransferase; FLS, flavonol synthase; ANR, anthocyanidin reductase. (b-d), correlation analysis between DEGs and DAFs of DK (b), DL (c), and AEX (d). ***, **, and * represent significant differences at P<0.001, P<0.010, and P<0.050 levels, respectively. The abbreviations are the same in the following figures.
Fig. 5 Flavonoid biosynthesis pathway in response to drought stress in DK (a), DL (b), and AEX (c) ecotypes of sandrice. The heatmap colored red and blue indicates up-regulation and down-regulation of structural genes and flavonoid metabolites, respectively. The square and circle presented structural gene and flavonoid metabolites, respectively.
Fig. 6 Quantitative real-time polymerase chain reaction (qRT-PCR) validation of the transcriptome data in DK (a1-a6), DL (b1-b6) and AEX (c1-c6) ecotypes of sandrice. The line graph and the histogram with error bars present the relative expression calculated by the 2−ΔΔCt method and fragments per kilobase million (FPKM) value generated by ribonucleic acid sequence (RNA-Seq), respectively.
[1]   Agati G, Azzarello E, Pollster S, et al. 2012. Flavonoids as antioxidants in plants: Location and functional significance. Plant Science, 196: 67-76.
doi: 10.1016/j.plantsci.2012.07.014 pmid: 23017900
[2]   Basu S, Ramegowda V, Kumar A, et al. 2016. Plant adaptation to drought stress. F1000Res, 5: 1554, doi: 10.12688/f1000research.7678.1.
[3]   Bhusal N, Lee M, Lee H, et al. 2021. Evaluation of morphological, physiological, and biochemical traits for assessing drought resistance in eleven tree species. Science of the Total Environment, 779: 146466, doi: 10.1016/j.scitotenv.2021.146466.
[4]   Dong N Q, Sun Y W, Guo T, et al. 2020. UDP-glucosyltransferase regulates grain size and abiotic stress tolerance associated with metabolic flux redirection in rice. Nature Communication, 11(1): 2629, doi: 10.1038/s41467-020-16403-5.
[5]   Easterling D R, Meehl G A, Parmesan C, et al. 2000. Climate extremes: Observations, modeling, and impacts. Science, 289(5487): 2068-2074.
doi: 10.1126/science.289.5487.2068 pmid: 11000103
[6]   Fang T Z, Zhou S S, Qian C J, et al. 2022. Integrated metabolomics and transcriptomics insights on flavonoid biosynthesis of a medicinal functional forage, Agriophyllum squarrosum (L.), based on a common garden trial covering six ecotypes. Frontiers in Plant Science, 13: 985572, doi: 10.3389/fpls.2022.985572.
[7]   Fang T Z, Qian C J, Daoura B G, et al. 2023. A novel TF molecular switch-mechanism found in two contrasting ecotypes of a psammophyte, Agriophyllum squarrosum, in regulating transcriptional drought memory. BMC Plant Biology, 23: 167, doi: 10.1186/s12870-023-04154-6.
[8]   Fang Y J, Xiong L Z. 2015. General mechanisms of drought response and their application in drought resistance improvement in plants. Cellular and Molecular Life Sciences, 72: 673-689.
doi: 10.1007/s00018-014-1767-0 pmid: 25336153
[9]   Ganeshpurkar A, Saluja A K. 2017. The pharmacological potential of rutin. Saudi Pharmaceutical Journal, 25(2): 149-164.
doi: 10.1016/j.jsps.2016.04.025 pmid: 28344465
[10]   Gao G R, Lv Z R, Zhang G Y, et al. 2021. An ABA-flavonoid relationship contributes to the differences in drought resistance between different sea buckthorn subspecies. Tree Physiology, 41(5): 744-755.
doi: 10.1093/treephys/tpaa155 pmid: 33184668
[11]   Gao Y G, Jin Y L, Guo W, et al. 2022. Metabolic and physiological changes in the roots of two oat cultivars in response to complex saline-alkali stress. Frontiers in Plant Science, 13: 835414, doi: 10.3389/fpls.2022.835414.
[12]   Gautam H, Sharma A, Trivedi P K. 2023. The role of flavonols in insect resistance and stress response. Current Opinion in Plant Biology, 73: 102353, doi: 10.1016/j.pbi.2023.102353.
[13]   Gharibi S, Tabatabaei B E S, Saeidi G, et al. 2019. The effect of drought stress on polyphenolic compounds and expression of flavonoid biosynthesis related genes in Achillea pachycephala Rech. f. Phytochemistry, 162: 90-98.
[14]   Ghorbanpour M, Varma A. 2017. Medicinal Plants and Environmental Challenges. Switzerland: Springer, 259-277.
[15]   Hao Z C, Hao F H, Singh V P, et al. 2018. Changes in the severity of compound drought and hot extremes over global land areas. Environmental Research Letters, 13: 124022, doi: 10.1088/1748-9326/aaee96.
[16]   Hodaei M, Rahimmalek M, Arzani A, et al. 2018. The effect of water stress on phytochemical accumulation, bioactive compounds and expression of key genes involved in flavonoid biosynthesis in Chrysanthemum morifolium L. Industrial Crops and Products, 120: 295-304.
[17]   Hou G D, Li S, Shang C Q, et al. 2022. Genome-wide characterization of chalcone synthase genes in sweet cherry and functional characterization of CpCHS 1 under drought stress. Frontiers in Plant Science, 13: 989959, doi: 10.3389/fpls.2022.989959.
[18]   Hu H C, Fei X T, He B B, et al. 2021. Integrated analysis of metabolome and transcriptome data for uncovering flavonoid components of Zanthoxylum bungeanum Maxim. leaves under drought stress. Frontiers in Nutrition, 8: 801244, doi: 10.3389/fnut.2021.801244.
[19]   Hu H C, Liu Y H, He B B, et al. 2022. Integrative physiological, transcriptome, and metabolome analysis uncovers the drought responses of two Zanthoxylum bungeanum cultivars. Industrial Crops and Products, 189: 115812, doi: 10.1016/j.indcrop.2022.115812.
[20]   Huang X, Chu G M, Wang J, et al. 2023. Integrated metabolomic and transcriptomic analysis of specialized metabolites and isoflavonoid biosynthesis in Sophora alopecuroides L. under different degrees of drought stress. Industrial Crops and Products, 197: 116595, doi: 10.1016/j.indcrop.2023.116595.
[21]   Ismail H, Maksimovic J D, Maksimovic V, et al. 2015. Rutin, a flavonoid with antioxidant activity, improves plant salinity tolerance by regulating K+ retention and Na+ exclusion from leaf mesophyll in quinoa and broad beans. Functional Plant Biology, 43(1): 75-86.
[22]   Jaakola L, Hohtola A. 2010. Effect of latitude on flavonoid biosynthesis in plants. Plant, Cell and Environment, 33(8): 1239-1247.
[23]   Jan R, Khan M, Asaf S, et al. 2022. Drought and UV radiation stress tolerance in rice is improved by over accumulation of non-enzymatic antioxidant flavonoids. Antioxidants, 11(5): 917, doi: 10.3390/antiox11050917.
[24]   Jansen M A K, Ač A, Klem K, et al. 2021. A meta-analysis of the interactive effects of UV and drought on plants. Plant, Cell and Environment, 45(1): 41-54.
[25]   Karimpour M. 2019. Effect of drought stress on RWC and chlorophyll content on wheat (Triticum durum L.) genotypes. World Essays Journal, 7(1): 52-56.
[26]   Kim Y H, Khan A L, Waqas M, et al. 2017. Silicon regulates antioxidant activities of crop plants under abiotic-induced oxidative stress: A review. Frontiers in Plant Science, 8: 510, doi: 10.3389/fpls.2017.00510.
[27]   Li B Z, Fan R N, Sun G L, et al. 2021. Flavonoids improve drought tolerance of maize seedlings by regulating the homeostasis of reactive oxygen species. Plant and Soil, 461: 389-405.
[28]   Li J Y, Wei J H, Song Y T, et al. 2023. Histone H3K 9 acetylation modulates gene expression of key enzymes in the flavonoid and abscisic acid pathways and enhances drought resistance of sea buckthorn. Physiologia Plantarum, 175(3): e13936, doi: 10.1111/ppl.13936.
[29]   Lu M N, He W J, Xu Z Y, et al. 2023. The effect of high altitude on ephedrine content and metabolic variations in two species of Ephedra. Frontiers in Plant Science, 14: 1236145, doi: 10.3389/fpls.2023.1236145.
[30]   Lv H W, Wang Q L, Luo M, et al. 2023. Phytochemistry and pharmacology of natural prenylated flavonoids. Archives of Pharmacal Research, 46(4): 207-272.
[31]   Negahdari R, Bohlouli S, Sharifi S, et al. 2021. Therapeutic benefits of rutin and its nanoformulations. Phytotherapy Research, 35(4): 1719-1738.
doi: 10.1002/ptr.6904 pmid: 33058407
[32]   Prasad P V V, Pisipati S R, Momčilović I, et al. 2011. Independent and combined effects of high temperature and drought stress during grain filling on plant yield and chloroplast EF-Tu expression in spring wheat. Journal of Agronomy and Crop Science, 197(6): 430-441.
[33]   Qian C J, Yin H X, Shi Y, et al. 2016. Population dynamics of Agriophyllum squarrosum, a pioneer annual plant endemic to mobile sand dunes, in response to global climate change. Scientific Reports, 6: 26613, doi: 10.1038/srep26613.
[34]   Qian C J, Yan X, Fang T Z, et al. 2021. Genomic adaptive evolution of sand rice (Agriophyllum squarrosum) and its implications for desert ecosystem restoration. Frontiers in Genetics, 12: 656061, doi: 10.3389/fgene.2021.656061.
[35]   Rampino P, Pataleo S, Gerardi C, et al. 2006. Drought stress response in wheat: Physiological and molecular analysis of resistant and sensitive genotypes. Plant, Cell and Environment, 29(12): 2143-2152.
[36]   Resham K, Khare P, Bishnoi M, et al. 2020. Neuroprotective effects of isoquercitrin in diabetic neuropathy via Wnt/beta-catenin signaling pathway inhibition. Biofactors, 46(3): 411-420.
[37]   Riaz A, Rasul A, Hussain G, et al. 2018. Astragalin: A bioactive phytochemical with potential therapeutic activities. Advances Pharmacological Sciences, 2018: 979462515, doi: 10.1155/2018/9794625.
[38]   Samanta A, Das G, Das S K. 2011. Roles of flavonoids in plants. International Journal of Pharmaceutics, 6(1): 12-35.
[39]   Sharma D K, Andersen S B, Ottosen C O, et al. 2015. Wheat cultivars selected for high Fv/Fm under heat stress maintain high photosynthesis, total chlorophyll, stomatal conductance, transpiration and dry matter. Physiologia Plantarum, 153(2): 284-298.
[40]   Shen N, Wang T F, Gan Q, et al. 2022. Plant flavonoids: Classification, distribution, biosynthesis, and antioxidant activity. Food Chemistry, 383: 132531, doi: 10.1016/j.foodchem.2022.132531.
[41]   Shi Y S, Yang L, Yu M F, et al. 2022. Seasonal variation influences flavonoid biosynthesis path and content, and antioxidant activity of metabolites in Tetrastigma hemsleyanum Diels & Gilg. PloS ONE, 17(4): e0265954, doi: 10.1371/journal.pone.0265954.
[42]   Shomali A, Das S, Arif N, et al. 2022. Diverse physiological roles of flavonoids in plant environmental stress responses and tolerance. Plants, 11(22): 3158, doi: 10.3390/plants11223158.
[43]   Singh P, Arif Y, Bajguz A, et al. 2021. The role of quercetin in plants. Plant Physiology and Biochemistry, 166: 10-19.
doi: 10.1016/j.plaphy.2021.05.023 pmid: 34087741
[44]   Sun S C, Xiong X P, Zhang X L, et al. 2020. Characterization of the Gh4CL gene family reveals a role of Gh4CL 7 in drought tolerance. BMC Plant Biology, 20: 125, doi: 10.1186/s12870-020-2329-2.
[45]   Valentova K, Vrba J, Bancirova M, et al. 2014. Isoquercitrin: Pharmacology, toxicology, and metabolism. Food and Chemical Toxicology, 68: 267-282.
doi: 10.1016/j.fct.2014.03.018 pmid: 24680690
[46]   Wang A M, Zhu M K, Luo Y H, et al. 2017. A sweet potato cinnamate 4-hydroxylase gene, IbC4H, increases phenolics content and enhances drought tolerance in tobacco. Acta Physiologiae Plantarum, 39: 276, doi: 10.1007/s11738-017-2551-1.
[47]   Xie Y Y, Wang X J, Silander J A. 2015. Deciduous forest responses to temperature, precipitation, and drought imply complex climate change impacts. Proceedings of the National Academy of Sciences of the United States of America, 112(44): 13585-13590.
[48]   Yadav B, Jogawat A, Rahman M S, et al. 2021. Secondary metabolites in the drought stress tolerance of crop plants: A review. Gene Reports, 23: 101040, doi: 10.1016/j.genrep.2021.101040.
[49]   Yang Z R, Cao Y B, Shi Y T, et al. 2023. Genetic and molecular exploration of maize environmental stress resilience: Towards sustainable agriculture. Molecular Plant, 16(10): 1496-1517.
[50]   Yeloojeh K A, Saeidi G, Sabzalian M R. 2020. Drought stress improves the composition of secondary metabolites in safflower flower at the expense of reduction in seed yield and oil content. Industrial Crops and Products, 154: 112496, doi: 10.1016/j.indcrop.2020.112496.
[51]   Yin C L, Zhao J C, Hu J L, et al. 2016a. Phenotypic variation of a potential food crop, Agriophyllum squarrosum, impacted by environmental heterogeneity. Scientia Sinica Vitae, 46(11): 1324-1335. (in Chinese)
[52]   Yin C L, Qian C J, Chen G X, et al. 2016b. The influence of selection of ecological differentiation to the phenotype polymorphism of Agriophyllum squarrosum. Journal of Desert Research, 36(2): 364-373. (in Chinese)
[53]   Yin X Y, Wang W D, Qian C J, et al. 2018. Analysis of metabolomics in Agriophyllum squarrosum based on UPLC-MS. Chinese Journal of Experimental Traditional Medical Formulae, 24(15): 51-56. (in Chinese)
[54]   Zhang L J, Li X X, Ma B, et al. 2017. The tartary buckwheat genome provides insights into rutin biosynthesis and abiotic stress tolerance. Molecular Plant, 10(9): 1224-1237.
[55]   Zhao P S, Shi L, Yan X, et al. 2023. Long-term feeding of sand rice (Agriophyllum squarrosum seed) can improve the antioxidant capacity of mice. Research in Cold and Arid Regions, 15(2): 105-112.
[56]   Zhao P S, Yan X, Qian C J, et al. 2024. Flavonoid synthesis pathway response to low-temperature stress in a desert medicinal plant, Agriophyllum squarrosum (sandrice). Genes, 15(9): 1228, doi: 10.3390/genes15091228.
[57]   Zhou S S, Yan X, Yang J, et al. 2021a. Variations in flavonoid metabolites along altitudinal gradient in a desert medicinal plant Agriophyllum squarrosum. Frontiers in Plant Science, 12: 683265, doi: 10.3389/fpls.2021.683265.
[58]   Zhou S S, Yang J, Qian C J, et al. 2021b. Organic acid metabolites involved in local adaptation to altitudinal gradient in Agriophyllum squarrosum, a desert medicinal plant. Journal of Plant Research, 134: 999-1011.
[1] SHEHZADI Anum, A AKRAM Nudrat, ALI Ayaz, ASHRAF Muhammad. Exogenously applied glycinebetaine induced alteration in some key physio-biochemical attributes and plant anatomical features in water stressed oat (Avena sativa L.) plants[J]. Journal of Arid Land, 2019, 11(2): 292-305.
[2] A BOZOROV Tohir, M USMANOV Rustam, Honglan YANG, A HAMDULLAEV Shukhrat, MUSAYEV Sardorbek, SHAVKIEV Jaloliddin, NABIEV Saidgani, Daoyuan ZHANG, A ABDULLAEV Alisher. Effect of water deficiency on relationships between metabolism, physiology, biomass, and yield of upland cotton (Gossypium hirsutum L.)[J]. Journal of Arid Land, 2018, 10(3): 441-456.
[3] Abdallah ATIA, Mokded RABHI, Ahmed DEBEZ, Chedly ABDELLY, Houda GOUIA, Chiraz CHAFFEI HAOUARI, Abderrazak SMAOUI. Ecophysiological aspects in 105 plants species of saline and arid environments in Tunisia[J]. Journal of Arid Land, 2014, 6(6): 762-770.
[4] TengFei YU, Qi FENG, JianHua SI, HaiYang XI, Wei LI. Patterns, magnitude, and controlling factors of hydraulic redistribution of soil water by Tamarix ramosissima roots[J]. Journal of Arid Land, 2013, 5(3): 396-407.
[5] ZhaoFeng CHANG, ShuJuan ZHU, FuGui HAN, ShengNian ZHONG. Differences in response of desert plants of different ecotypes to climate warming: a case study in Minqin, Northwest China[J]. Journal of Arid Land, 2012, 4(2): 140-150.