Please wait a minute...
Journal of Arid Land
Journal of Arid Land  2026, Vol. 18 Issue (1): 131-149    DOI: 10.1016/j.jaridl.2025.12.001     CSTR: 32276.14.JAL.20250394
Research article     
Effect of drought and elevated temperature on the physiological and biochemical properties of C3 and C4 halophytes in Amaranthaceae
Zulfira RAKHMANKULOVA1, Elena SHUYSKAYA1, Maria PROKOFIEVA1, Kristina TODERICH2,3,*(), Luizat SAIDOVA1, ZHANG Yuanming4
1Timiryazev Institute of Plant Physiology, Russian Academy of Sciences, Moscow 127276, Russia
2International Platform for Drylands Research and Education, Tottori 680-0000, Japan
3Institute of Agrobiotechnologies and Food Security, Samarkand State University, Samarkand 140104, Uzbekistan
4Xinjiang Institute of Ecology and Geography, Chinese Academy of Sciences, Urumqi 830011, China
Download: HTML     PDF(1258KB)
Export: BibTeX | EndNote (RIS)      

Abstract  

Rising temperatures and increased droughts caused by climate change significantly reduce crop yields. Halophytes with different photosynthetic metabolism types have specific mechanisms for resistance to climatic factors. This study analyzed the morphophysiological, biochemical, and molecular-genetic mechanisms of tolerance and adaptation in halophytes, promising candidates for the restoration of salt affected lands in arid and semi-arid areas. Experiments under drought (D) and elevated temperature (eT), as well as their combined action (eT+D), were performed on Atriplex verrucifera M. Bied. (C3 plant) and Climacoptera crassa (M. Bieb.) Botsch. (C4-NAD-ME plant) with different types of photosynthesis. The activity of photosystem I (PSI) and the efficiency of photosystem II (PSII) were measured, along with the expression of genes involved in the light (psaA, psaB, psbA, CAB, Fd1, PGR5, and ndhH) and dark (rbcL, Ppc2, and PPDK) reactions of photosynthesis. The content of key carboxylating enzymes ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) and phosphoenolpyruvate carboxylase (PEPC), as well as the photorespiration enzyme glycine decarboxylase (GDC), were assessed. Plant growth and water-salt balance parameters, and activity of enzymes in the malate dehydrogenase (MDH) system nicotinamide adenine dinucleotide (phosphate) (NAD(P))-MDH and NAD(P)-malic enzyme (ME) were also examined. A multivariate analysis of the experimental results revealed that A. verrucifera and C. crassa were both resistant to the effects of these climatic stressors. The tolerance mechanisms of both species were significantly influenced by a high level of photosynthetic plasticity. Nevertheless, differences were observed in the protective mechanisms underlying tolerance. In the C3 species, dissipative processes associated with non-photochemical quenching (NPQ) of PSII and MDH system enzymes (malate valves) were activated, particularly under osmotic stress. The negative effects in the C3 plants were caused by the combined action of eT+D, which was compensated by an increased expression of rbcL, psaA, CAB, and especially PGR5, i.e., genes encoding Rubisco large subunit and PSI components: apoproteins A, chlorophyll a/b-associated protein (CAB) of light-harvesting complex, and proton gradient regulation 5 (PGR5) protein of the main pathway of cyclic electron transport (CET) around PSI. In C4 species, the protective MDH complex was expressed to a lesser extent, but activation of the C4 carbon-concentrating mechanism (CCM) and upregulation of PGR5 expression were observed, particularly under the individual action of the factors. Under the combined stress of eT+D, C. crassa exhibited a synergistic effect, where the increase in NPQ level and NAD-ME activity, as well as decrease in NADP-ME activity was less pronounced compared with the effect of singular factors. Comparative physiological, biochemical, and molecular analyses of how C3 and C4 species response to individual and combined climatic factors provide new insights into sustainable plant adaptation strategies in the face of global climate change. Considering the high nutritional value of these two fodder species, a technological approach could be developed to improve the productivity of salt affected lands.

Key words： Atriplex verrucifera M. Bied.      Climacoptera crassa (M. Bieb.) Botsch.      Chenopodiaceae      photosynthesis      cyclic electron transport (CET)      malate valves      arid land     
Received: 22 August 2025      Published: 31 January 2026
Corresponding Authors: *Kristina TODERICH (E-mail: ktoderich@bio.mie-u.ac.jp; ktoderich@yahoo.com)
Service
E-mail this article
Add to my bookshelf
Add to citation manager
E-mail Alert
RSS
Articles by authors
Zulfira RAKHMANKULOVA
Elena SHUYSKAYA
Maria PROKOFIEVA
Kristina TODERICH
Luizat SAIDOVA
ZHANG Yuanming
Cite this article:

Zulfira RAKHMANKULOVA, Elena SHUYSKAYA, Maria PROKOFIEVA, Kristina TODERICH, Luizat SAIDOVA, ZHANG Yuanming. Effect of drought and elevated temperature on the physiological and biochemical properties of C3 and C4 halophytes in Amaranthaceae. Journal of Arid Land, 2026, 18(1): 131-149.

URL:

http://jal.xjegi.com/10.1016/j.jaridl.2025.12.001     OR     http://jal.xjegi.com/Y2026/V18/I1/131

Primer Gene ID Protein 5'-3' sequence
rbcL (Climacoptera crassa (M. Bieb.) Botsch.) AY270083.1 Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (RbcL) ACGTGCTCTACGTTTGGAGG
TCCCAATAGGGGACGACCAT
rbcL (Atriplex verrucifera M. Bied.) HM587606.1 RbcL AGCGTTACGTCTGTCTGGTG
CCGCGACTTCGGTCTTTTTC
Ppc2 LOC110737782 Phosphoenolpyruvate carboxylase 2 (PEPC2) GGAGGTGGACCTACCCATCT
CTCAAGAGTGGCAGCAGTGA
PPDK MK674493.1 Pyruvate phosphate dikinase (PPDK) GGTAAGGAATGAAACTAGCCCAGAGG
GATCTCAGAGCACCCTGAAACACAAC
psaA OK539756.1 Apoprotein A1 of photosystem I (PSI) CCGCGCCCGCTAAATAAAAA
AATGGGTGGCTCCGTGATTT
psaB LOC32958940 Apoprotein A2 of PSI GAACCGCGTGCATCTAAAGC
GCCTGGCTGGTTAAATGCTG
psbA AY251266.1 D1 protein of photosystem II (PSII) CAGGCTGAGCACAACATCCT AATAGGGAGCCGCCGAATAC
CAB LOC110735177 Chlorophyll a/b-binding protein (CAB) of the light-harvesting complex TTCCAGGAGGTCAAGCAACC
AGCTCCACCAGGGTACTTCT
Fd1 LOC110699227 Ferredoxin 1 (a linear electron transport (LET) participant) GAGTTTGAGTGCCCGGATGA
CTGGTCGAGAGTACCAGACG
PGR5 AY617078.1 Proton gradient regulation 5 (PGR5) protein (a key part of the main cyclic electron transport (CET) pathway of PSI) CGCAGCCCATGATGAAGAAT
AACCTGTGAGTGAAGGGCAA
ndhH LOC32959000 H subunit of the reduced nicotinamide adenine dinucleotide (NAD) dehydrogenase-like (NDH) complex in the second CET pathway of PSI GGCCATTTCACCGATTCGTA
GGCCCTATGCTACGAGCTTC
Ubiquitin 10 (UBQ10) LOC110721034 Ubiquitin 10 (reference gene for real-time-quantitative polymerase chain reaction (RT-qPCR)) CTTGTCCTTCGTCTCCGTGG CGCCATATACTTCACGCCGA
β-Tubulin XM_021890176 β-Tubulin (second reference gene for RT-qPCR) ACCGGAGAAGGTATGGACGA GTACTCTTCCTCATCGGCGG
Table S1 List of primers used in this study
Fig. 1 Growth parameters (a-c), water-salt balance (d-f), and oxidative stress (g and h) indicators in Atriplex verrucifera M. Bied. and Climacoptera crassa (M. Bieb.) Botsch. plants under individual and combined effects of drought (D) and elevated temperature (eT). Control plants (CK) grew at 25°C without drought treatment. DW, dry weight; FW, fresh weight; MDA, malondialdehyde. Values are means±standard errors (SEs) from three biological replicates. Different letters indicate statistically significant differences from the control at P<0.05 level (Tukey's test).
Fig. 2 Evaluation of the activity of photosystem I (PSI; a) and the efficiency of photosystem II (PSII; b-d) functioning in A. verrucifera and C. crassa plants under individual and combined effects of drought and elevated temperature. P700, activity of cyclic electron transport (CET) of PSI; Fv/Fm, maximum quantum yield of PSII photochemistry in dark‐adapted leaves; Fv'/Fm', effective quantum yield of PSII photochemistry under a given light intensity; NPQ, non‐photochemical quenching. Values are means±SEs from three biological replicates. Different letters indicate statistically significant differences from the control at P<0.05 level (Tukey's test).
Fig. 3 Expression of photosynthetic gene in A. verrucifera (a) and C. crassa (b) plants under individual and combined effects of drought and elevated temperature. rbcL, gene encoding the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco); Ppc2, gene encoding phosphoenolpyruvate carboxylase 2 (PEPC2); PPDK, gene encoding pyruvate phosphate dikinase (PPDK); psaA and psaB, genes encoding the apoproteins A1 and A2 of PSI; psbA, gene encoding the D1 protein of PSII; CAB, gene encoding chlorophyll a/b-binding protein (CAB) of the light-harvesting complex; Fd1, gene encoding ferredoxin 1; PGR5, gene encoding proton gradient regulation 5 (PGR5) protein, a key component of the main CET pathway of PSI; ndhH, gene encoding the H subunit of the reduced nicotinamide adenine dinucleotide (NAD) dehydrogenase-like (NDH) complex of second CET pathway of PSI. Values are means±SEs from three biological replicates. *, significance at P<0.05 level (Tukey's test).
Fig. 4 Western blotting analysis of relative content of photosynthetic enzymes in A. verrucifera (a) and C. crassa (b) plants under individual and combined effects of drought and elevated temperature. RbcL, Ribulose large subunit; PEPC, phosphoenolpyruvate carboxylase; GLDP, glycine decarboxylase (GDC) P protein. Values are means±SEs from three biological replicates. Different letters indicate statistically significant differences from the control at P<0.05 level (Tukey's test).
Fig. 5 Activity of malate dehydrogenase (MDH) system enzymes nicotinamide adenine dinucleotide (phosphate) (NAD(P))-MDH (a and b) and NAD(P)-malic enzyme (ME; c and d) in A. verrucifera and C. crassa plants under individual and combined effects of drought and elevated temperature. Values are means±SEs from three biological replicates. Different letters indicate statistically significant differences from the control at P<0.05 level (Tukey's test).
Fig. 6 Multivariate principal component analysis (PCA) of physiological and biochemical parameters in A. verrucifera (a) and C. crassa (b) plants under individual and combined effects of drought and elevated temperature. PC1, first principal component; PC2, second principal component.
Parameter A. verrucifera C. crassa
PC1 PC2 PC1 PC2
Dry weight 0.019 0.096 0.179 ‒0.382
Water content of shoot 0.178 0.273 0.219 ‒0.141
Proline content 0.344 ‒0.130 ‒0.006 0.345
Sodium ion (Na+) concentration 0.061 0.172 ‒0.008 ‒0.457
Potassium ion (K+) concentration ‒0.117 0.309 0.139 ‒0.007
Malondialdehyde (MDA) content ‒0.098 ‒0.422 ‒0.373 0.096
RbcL content 0.214 0.365 0.053 0.260
GLDP content 0.355 ‒0.191 ‒0.065 ‒0.392
Activity of CET PSI 0.062 ‒0.206 ‒0.325 ‒0.055
Fv/Fm ‒0.063 ‒0.461 ‒0.344 0.127
Fv′/Fm′ 0.154 0.037 ‒0.240 0.013
Non-photochemical quenching (NPQ) ‒0.347 ‒0.275 0.317 0.036
Activity of NAD-MDH ‒0.400 0.006 0.339 ‒0.076
Activity of NADP-MDH ‒0.398 0.176 0.167 ‒0.138
Activity of NAD-ME ‒0.384 0.098 0.309 0.253
Activity of NADP-ME ‒0.087 0.020 ‒0.334 ‒0.070
Table S2 Loding factor of principal component analysis (PCA) of the physiological and biochemical data in A. verrucifera and C. crassa plants under individual and combined effects of drought and elevated temperature
Fig. S1 Heatmap of changes in physiology-biochemical parameters (a and b) and gene expression levels (c and d) in A. verrucifera and C. crassa plants under individual and combined effects of drought and elevated temperature relative to control plants.
[1]   Alfonso S U, Brüggemann W. 2012. Photosynthetic responses of C3 and three C4 species of the genus Panicum (s.l.) with different metabolic subtypes to drought stress. Photosynthesis Research, 112: 175-191.
doi: 10.1007/s11120-012-9763-4
[2]   Alric J, Johnson X. 2017. Alternative electron transport pathways in photosynthesis: a confluence of regulation. Current Opinion in Plant Biology, 37: 78-86.
doi: S1369-5266(16)30188-1 pmid: 28426976
[3]   Ashraf M, Harris P J C. 2013. Photosynthesis under stressful environments: An overview. Photosynthetica, 51(2): 163-190.
doi: 10.1007/s11099-013-0021-6
[4]   Babayev H, Mehvaliyeva U, Aliyeva M, et al. 2014. The study of NAD-malic enzyme in Amaranthus cruentus L. under drought. Plant Physiology and Biochemistry, 81: 84-89.
doi: 10.1016/j.plaphy.2013.12.022 pmid: 24444721
[5]   Bates L S, Waldren R P, Teare I D. 1973. Rapid determination of free proline for water stress studies. Plant Soil, 39: 205-207.
doi: 10.1007/BF00018060
[6]   Bianconi M E, Sotelo G, Curran E V, et al. 2022. Upregulation of C4 characteristics does not consistently improve photosynthetic performance in intraspecific hybrids of a grass. Plant, Cell & Environment, 45(5): 1398-1411.
doi: 10.1111/pce.v45.5
[7]   Brestic M, Zivcak M. 2013. PSII fluorescence techniques for measurement of drought and high temperature stress signal in crop plants: protocols and applications.In: RoutG R, DasBandhu A. Molecular Stress Physiology of Plants. New Delhi: Springer, 87-131.
[8]   Brignone N F, Pozner R, Denham S S. 2022. Macroevolutionary trends and diversification dynamics in Atripliceae (Amaranthaceae s.l., Chenopodioideae): a first approach. Annals of Botany, 130(2): 199-214.
doi: 10.1093/aob/mcac085 pmid: 35737947
[9]   Cacefo V, Ribas A F, Zilliani R R, et al. 2019. Decarboxylation mechanisms of C4 photosynthesis in Saccharum spp.: increased PEPCK activity under water-limiting conditions. BMC Plant Biology, 19(1): 144, doi: 10.1186/s12870-019-1745-7.
[10]   Calone R, Cellini A, Manfrini L, et al. 2021. The C4 Atriplex halimus vs. the C3 Atriplex hortensis: Similarities and differences in the salinity stress response. Agronomy, 11(10): 1967, doi: 10.3390/agronomy11101967.
[11]   Carmo-Silva A E, Bernardes da Silva A, Keys A J, et al. 2008. The activities of PEP carboxylase and the C4 acid decarboxylases are little changed by drought stress in three C4 grasses of different subtypes. Photosynthesis Research, 97(3): 223-233.
doi: 10.1007/s11120-008-9329-7 pmid: 18629606
[12]   Carmo-Silva A E, Salvucci M E. 2012. The temperature response of CO2 assimilation, photochemical activities and Rubisco activation in Camelina sativa, a potential bioenergy crop with limited capacity for acclimation to heat stress. Planta, 236(5): 1433-1445.
doi: 10.1007/s00425-012-1691-1 pmid: 22733425
[13]   Chadee A, Alber N A, Dahal K, et al. 2021. The complementary roles of chloroplast cyclic electron transport and mitochondrial alternative oxidase to ensure photosynthetic performance. Frontiers in Plant Science, 12: 748204, doi: 10.3389/fpls.2021.748204.
[14]   Chen Q Q, Wang B P, Ding H Y, et al. 2019. Review: The role of NADP-malic enzyme in plants under stress. Plant Science, 281: 206-212.
doi: S0168-9452(18)31029-X pmid: 30824053
[15]   Chen S M, Peng W M H, Ansah E O, et al. 2022. Encoded C4 homologue enzymes genes function under abiotic stresses in C3 plant. Plant Signaling & Behavior, 17(1): 2115634, doi: 10.1080/15592324.2022.2115634.
[16]   Degen G E, Orr D J, Carmo-Silva E. 2021. Heat-induced changes in the abundance of wheat Rubisco activase isoforms. New Phytologist, 229: 1298-1311.
doi: 10.1111/nph.v229.3
[17]   Demircan N, Sonmez M C, Akyol T Y, et al. 2024. Alternative electron sinks in chloroplasts and mitochondria of halophytes as a safety valve for controlling ROS production during salinity. Physiologia Plantarum, 176(3): e14397, doi: 10.1111/ppl.14397.
[18]   Dietz K J. 2021. Synergism and antagonism in plant acclimation to abiotic stress combinations. Turkish Journal of Botany, 45(1): 587-600.
doi: 10.3906/bot-2108-45
[19]   Doubnerová Hýsková V, Miedzińska L, Dobrá J, et al. 2014. Phosphoenolpyruvate carboxylase, NADP-malic enzyme, and pyruvate, phosphate dikinase are involved in the acclimation of Nicotiana tabacum L. to drought stress. Journal of Plant Physiology, 171(5): 19-25.
doi: 10.1016/j.jplph.2013.10.017 pmid: 24484954
[20]   Edwards G E, Voznesenskaya E V. 2010. Chapter 4 C4 photosynthesis: kranz forms and single-cell C4 in terrestrial plants. In: Raghavendra A S, Sage R F. C4 Photosynthesis and Related CO2 Concentrating Mechanisms. Dordrecht: Springer, 29-61.
[21]   Elsässer M, Feitosa-Araujo E, Lichtenauer S, et al. 2020. Photosynthetic activity triggers pH and NAD redox signatures across different plant cell compartments. [2025-04-28].https://www.biorxiv.org/content/10.1101/2020.10.31.363051v1.full.pdf.
[22]   Eprintsev A T, Fedorina O S. 2007. Functioning of malate dehydrogenase system in mesophyll and bundle sheath cells of maize leaves under salt stress conditions. Russian Journal of Plant Physiology, 54(6): 728-735.
doi: 10.1134/S1021443707060027
[23]   Fan Y Z, Asao S, Furbank R T, et al. 2022. The crucial roles of mitochondria in supporting C4 photosynthesis. New Phytologist, 233(3): 1083-1096.
doi: 10.1111/nph.v233.3
[24]   Flowers T J, Colmer T D. 2008. Salinity tolerance in halophytes. New Phytologist, 179(4): 945-963.
doi: 10.1111/j.1469-8137.2008.02531.x pmid: 18565144
[25]   Flowers T J, Colmer T D. 2015. Plant salt tolerance: adaptations in halophytes. Annals of Botany, 115(3): 327-331.
pmid: 25844430
[26]   Furbank R T. 2017. Walking the C4 pathway: past, present, and future. Journal of Experimental Botany, 67(2): 4057-4066.
doi: 10.1093/jxb/erw161
[27]   Ghannoum O, von Caemmerer S, Conroy J P. 2002. The effect of drought on plant water use efficiency of nine NAD-ME and nine NADP-ME C4 Australian grasses. Functional Plant Biology, 29(11): 1337-1348.
doi: 10.1071/FP02056 pmid: 32688732
[28]   Ghannoum O, Evans J R, Chow W S, et al. 2005. Faster Rubisco is the key to superior nitrogen-use efficiency in NADP-malic enzyme relative to NAD-malic enzyme C4 grasses. Plant Physiology, 137(2): 638-650.
doi: 10.1104/pp.104.054759 pmid: 15665246
[29]   Ghannoum O. 2009. C4 photosynthesis and water stress. Annals of Botany, 103(4): 635-644.
doi: 10.1093/aob/mcn093 pmid: 18552367
[30]   Hamed K B, Ellouzi H, Talbi O Z, et al. 2013. Physiological response of halophytes to multiple stresses. Functional Plant Biology, 40(9): 883-896.
doi: 10.1071/FP13074 pmid: 32481158
[31]   Hasanuzzaman M, Raihan M R H, Masud A A C, et al. 2021. Regulation of reactive oxygen species and antioxidant defense in plants under salinity. International Journal of Molecular Sciences, 22(17): 9326, doi: 10.3390/ijms22179326.
[32]   Hatch M D. 1971. The C4 pathway of photosynthesis. Evidence for an intermediate pool of carbon dioxide and the identity of the donor C4-dicarboxylic acid. Biochemical Journal, 125(2): 425-432.
pmid: 5144745
[33]   Hatch M D, Tsuzuki M, Edwards G E. 1982. Determination of NAD malic enzymes in leaves of C(4) plants: effects of malate dehydrogenase and other factors. Plant Physiology, 69(2): 483-491.
doi: 10.1104/pp.69.2.483 pmid: 16662234
[34]   Hatch M D. 1987. C4 photosynthesis: a unique elend of modified biochemistry, anatomy and ultrastructure. Biochimica et Biophysica Acta (BBA) - Reviews on Bioenergetics, 895(2): 81-106.
doi: 10.1016/S0304-4173(87)80009-5
[35]   Heath R L, Packer L. 1968. Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Archives of Biochemistry and Biophysics, 125(1): 180-198.
[36]   Ishikawa N, Takabayashi A, Sato F, et al. 2016. Accumulation of the components of cyclic electron flow around photosystem I in C4 plants, with respect to the requirements for ATP. Photosynthesis Research, 129(3): 261-277.
doi: 10.1007/s11120-016-0251-0 pmid: 27017612
[37]   Jacoby R P, Taylor N L, Millar A H. 2011. The role of mitochondrial respiration in salinity tolerance. Trends in Plant Science, 16(11): 614-623.
doi: 10.1016/j.tplants.2011.08.002 pmid: 21903446
[38]   Jithesh M N, Prashanth S R, Sivaprakash K R, et al. 2006. Antioxidative response mechanisms in halophytes: their role in stress defence. Journal of Genetics, 85(3): 237-254.
pmid: 17406103
[39]   Koteyeva N K, Voznesenskaya E V, Edwards G E. 2015. An assessment of the capacity for phosphoenolpyruvate carboxykinase to contribute to C4 photosynthesis. Plant Science, 235: 70-80.
doi: 10.1016/j.plantsci.2015.03.004 pmid: 25900567
[40]   Krämer M, Kunz H-H. 2021. Indirect export of reducing equivalents from the chloroplast to resupply NADP for C3 photosynthesis—growing importance for stromal NAD(H)? Frontiers in Plant Science, 12: 719003, doi: 10.3389/fpls.2021.719003.
[41]   Krieger-Liszkay A, Shimakawa G. 2022. Regulation of the generation of reactive oxygen species during photosynthetic electron transport. Biochemical Society Transactions, 50(2): 1025-1034.
doi: 10.1042/BST20211246 pmid: 35437580
[42]   Lawlor D W. 1995. Effects of water deficit on photosynthesis. In: SmirnoffM. Environment and Plant Metabolism:Flexibility and Acclimation. Oxford: Bios Scientific Publishers, 129-160.
[43]   Le X Y H, Millar A H. 2023. The diversity of substrates for plant respiration and how to optimize their use. Plant Physiology, 191(4): 2133-2149.
doi: 10.1093/plphys/kiac599
[44]   Lee S C, Luan S. 2012. ABA signal transduction at the crossroad of biotic and abiotic stress responses. Plant, Cell & Environment, 35(1): 53-60.
doi: 10.1111/pce.2012.35.issue-1
[45]   Lin H C, Arrivault S, Coe R A, et al. 2020. A partial C4 photosynthetic biochemical pathway in rice. Frontiers in Plant Science, 11: 564463, doi: 10.3389/fpls.2020.564463.
[46]   Maier A, Zell M B, Maurino V G. 2011. Malate decarboxylases: evolution and roles of NAD(P)-ME isoforms in species performing C(4) and C(3) photosynthesis. Journal of Experimental Botany, 62(9): 3061-3069.
doi: 10.1093/jxb/err024 pmid: 21459769
[47]   Martins-Noguerol R, Rico-Jiménez D, Matías L, et al. 2024. Effects of drought and increased temperature on phytochemical traits of the edible halophyte Crithmum maritimum: Perspectives for future climatic scenarios. Environmental and Experimental Botany, 226: 105924, doi: 10.1016/j.envexpbot.2024.105924.
[48]   Munekage Y, Hashimoto M, Miyake C, et al. 2004. Cyclic electron flow around photosystem I is essential for photosynthesis. Nature, 429: 579-582.
doi: 10.1038/nature02598
[49]   Nakamura N, Iwano M, Havaux M, et al. 2013. Promotion of cyclic electron transport around photosystem I during the evolution of NADP-malic enzyme‐type C4 photosynthesis in the genus Flaveria. New Phytologist, 199(3): 832-842.
doi: 10.1111/nph.12296 pmid: 23627567
[50]   Opoku E, Sahu P P, Findurová H, et al. 2024. Differential physiological and production responses of C3 and C4 crops to climate factor interactions. Frontiers in Plant Science, 15: 1345462, doi: 10.3389/fpls.2024.1345462.
[51]   Panda S K, Gupta D, Patel M, et al. 2024. Functionality of reactive oxygen species (ROS) in plants: Toxicity and control in Poaceae crops exposed to abiotic stress. Plants, 13(15): 2071, doi: 10.3390/plants13152071.
[52]   Perdomo J A, Capó-Bauçà S, Carmo-Silva E, et al. 2017. Rubisco and Rubisco activase play an important role in the biochemical limitations of photosynthesis in rice, wheat, and maize under high temperature and water deficit. Frontiers in Plant Science, 8: 490, doi: 10.3389/fpls.2017.00490.
pmid: 28450871
[53]   Pyankov V I, Kuzmin A N, Demidov E D, et al. 1992. Diversity of biochemical pathways of CO2 fixation in plants of the families Poaceae and Chenopodiaceae from arid zone of Central Asia. Soviet Plant Physiology, 39(4): 411-420.
[54]   Qiu N, Lu C. 2003. Enhanced tolerance of photosynthesis against high temperature damage in salt-adapted halophyte Atriplex centralasiatica plants. Plant, Cell & Environment, 26(7): 1137-1145.
doi: 10.1046/j.1365-3040.2003.01038.x
[55]   Rakhmankulova Z F, Shuyskaya E V, Shcherbakov A V, et al. 2015. Content of proline and flavonoids in the shoots of halophytes inhabiting the South Urals. Russian Journal of Plant Physiology, 62(1): 71-79.
doi: 10.1134/S1021443715010112
[56]   Rao X L, Dixon R A. 2016. The differences between NAD-ME and NADP-ME subtypes of C4 photosynthesis: more than decarboxylating enzymes. Frontiers in Plant Science, 7: 1525, doi: 10.3389/fpls.2016.01525.
[57]   Rao X L, Dixon R A. 2019. Corrigendum: The differences between NAD-ME and NADP-ME subtypes of C4 photosynthesis: more than decarboxylating enzymes. Frontiers in Plant Science, 10: 247, doi: 10.3389/fpls.2019.00247.
[58]   Sage R F, Kubien D S. 2007. The temperature response of C(3) and C(4) photosynthesis Plant, Cell & Environment, 30(9): 1086-1106.
doi: 10.1111/pce.2007.30.issue-9
[59]   Samiei L, Pahnehkolayi M D, Karimian Z, et al. 2020. Morpho-physiological responses of halophyte Climacoptera crassa to salinity and heavy metal stresses in in vitro condition. South African Journal of Botany, 131: 468-474.
doi: 10.1016/j.sajb.2020.03.037
[60]   Selinski J, Scheibe R. 2019. Malate valves: old shuttles with new perspectives. Plant Biology, 21(Suppl 1): 21-30.
doi: 10.1111/plb.2019.21.issue-S1
[61]   Shen L L, Tang K L, Wang W D, et al. 2022. Architecture of the chloroplast PSI-NDH supercomplex in Hordeum vulgare. Nature, 601: 649-654.
doi: 10.1038/s41586-021-04277-6
[62]   Shikanai T. 2016. Chloroplast NDH: a different enzyme with a structure similar to that of respiratory NADH dehydrogenase. Biochimica et Biophysica Acta (BBA) - Bioenergetics, 1857(7): 1015-1022.
doi: 10.1016/j.bbabio.2015.10.013
[63]   Shiri M, Rabhi M, El Amrani A, et al. 2015. Cross-tolerance to abiotic stresses in halophytes: application for phytoremediation of organic pollutants. Acta Physiologiae Plantarum, 37(10): 209, doi: 10.1007/s11738-015-1954-0.
[64]   Shiri M, Rabhi M, Abdelly C, et al. 2016. Moderate salinity reduced phenanthrene-induced stress in the halophyte plant model Thellungiella salsuginea compared to its glycophyte relative Arabidopsis thaliana: Cross talk and metabolite profiling. Chemosphere, 155: 453-462.
doi: S0045-6535(16)30566-5 pmid: 27139124
[65]   Singh J, Garai S, Das S, et al. 2022. Role of C4 photosynthetic enzyme isoforms in C3 plants and their potential applications in improving agronomic traits in crops. Photosynthesis Research, 154(3): 233-258.
doi: 10.1007/s11120-022-00978-9
[66]   Takabayashi A, Kishine M, Asada K, et al. 2005. Differential use of two cyclic electron flows around photosystem I for driving CO2-concentration mechanism in C4 photosynthesis. Proceedings of the National Academy of Sciences of the United States of America, 102(46): 16898-16903.
[67]   Tian W, Su C F, Zhang N, et al. 2024. Simulation of the physiological and photosynthetic characteristics of C3 and C4 plants under elevated temperature and CO2 concentration. Ecological Modelling, 495: 110805, doi: 10.1016/j.ecolmodel.2024.110805.
[68]   Tiwari Y K, Yadav S K. 2019. High temperature stress tolerance in maize (Zea mays L.): Physiological and molecular mechanisms. Journal of Plant Biology, 62: 93-102.
doi: 10.1007/s12374-018-0350-x
[69]   Toderich K N, Shuyskaya E V, Ismail S, et al. 2009. Phytogenic resources of halophytes of Central Asia and their role for rehabilitation of sandy desert degraded rangelands. Land Degradation & Development, 20(4): 386-396.
doi: 10.1002/ldr.v20:4
[70]   Tomar R S, Kataria S, Jajoo A. 2021. Behind the scene: Critical role of reactive oxygen species and reactive nitrogen species in salt stress tolerance. Journal of Agronomy and Crop Science, 207(4): 577-588.
doi: 10.1111/jac.v207.4
[71]   Tsuchida H, Tamai T, Fukayama H, et al. 2001. High level expression of C4-specific NADP-malic enzyme in leaves and impairment of photoautotrophic growth in a C3 plant, rice. Plant and Cell Physiology, 42(2): 138-145.
pmid: 11230567
[72]   Voon C P, Law Y S, Guan X Q, et al. 2021. Modulating the activities of chloroplasts and mitochondria promotes adenosine triphosphate production and plant growth. Quantitative Plant Biology, 2: e7, doi: 10.1017/qpb.2021.7.
[73]   Wang L, Wei J, Shi X Y, et al. 2023. Identification of the light-harvesting chlorophyll a/b binding protein gene family in peach (Prunus persica L.) and their expression under drought stress. Genes, 14(7): 1475, doi: 10.3390/genes14071475.
[74]   Wang Y, Bräutigam A, Weber A P M, et al. 2014. Three distinct biochemical subtypes of C4 photosynthesis? A modelling analysis. Journal of Experimental Botany, 65(13): 3567-3578.
doi: 10.1093/jxb/eru058 pmid: 24609651
[75]   Wen Z B, Zhang M L. 2017. Possible involvement of phosphoenolpyruvate carboxylase and NAD-malic enzyme in response to drought stress. A case study: a succulent nature of the C4-NAD-ME type desert plant, Salsola lanata (Chenopodiaceae). Functional Plant Biology, 44(12): 1219-1228.
[76]   Yan K, Chen P, Shao H, et al. 2012. Responses of photosynthesis and photosystem II to higher temperature and salt stress in sorghum. Journal of Agronomy and Crop Science, 198(3): 218-225.
doi: 10.1111/jac.2012.198.issue-3
[77]   Yıldız M, Terzi H. 2021. Comparative analysis of salt-induced changes in the root physiology and proteome of the xero-halophyte Salsola crassa. Brazilian Journal of Botany, 44: 33-42.
doi: 10.1007/s40415-020-00695-4
[1] Teame G KEBEDE, Emiru BIRHANE, Kiros-Meles AYIMUT, Yemane G EGZIABHER. Arbuscular mycorrhizal fungi improve biomass, photosynthesis, and water use efficiency of Opuntia ficus-indica (L.) Miller under different water levels[J]. Journal of Arid Land, 2023, 15(8): 975-988.
[2] CHEN Yingying, LIN Yajun, ZHOU Xiaobing, ZHANG Jing, YANG Chunhong, ZHANG Yuanming. Effects of drought treatment on photosystem II activity in the ephemeral plant Erodium oxyrhinchum[J]. Journal of Arid Land, 2023, 15(6): 724-739.
[3] YANG Yuxin, GONG Lu, TANG Junhu. Reclamation during oasification is conducive to the accumulation of the soil organic carbon pool in arid land[J]. Journal of Arid Land, 2023, 15(3): 344-358.
[4] WANG Chunyuan, YU Minghan, DING Guodong, GAO Guanglei, ZHANG Linlin, HE Yingying, LIU Wei. Size- and leaf age-dependent effects on the photosynthetic and physiological responses of Artemisia ordosica to drought stress[J]. Journal of Arid Land, 2021, 13(7): 744-758.
[5] Juan M ZEBERIO, Carolina A PéREZ. Rehabilitation of degraded areas in northeastern Patagonia, Argentina: Effects of environmental conditions and plant functional traits on performance of native woody species[J]. Journal of Arid Land, 2020, 12(4): 653-665.
[6] ZHOU Honghua, CHEN Yaning, ZHU Chenggang, YANG Yuhai, YE Zhaoxia. Water transport and water use efficiency differ among Populus euphratica Oliv. saplings exposed to saline water irrigation[J]. Journal of Arid Land, 2019, 11(6): 866-879.
[7] Yang YU, Yuanyue PI, Xiang YU, Zhijie TA, Lingxiao SUN, DISSE Markus, Fanjiang ZENG, Yaoming LI, Xi CHEN, Ruide YU. Climate change, water resources and sustainable development in the arid and semi-arid lands of Central Asia in the past 30 years[J]. Journal of Arid Land, 2019, 11(1): 1-14.
[8] Yinan ZHAO, Hongqing YU, Tao ZHANG, Jixun GUO. Mycorrhizal colonization of chenopods and its influencing factors in different saline habitats, China[J]. Journal of Arid Land, 2017, 9(1): 143-152.
[9] JIN Jia, WANG Quan, LI Lanhai. Long-term oscillation of drought conditions in the western China: an analysis of PDSI on a decadal scale[J]. Journal of Arid Land, 2016, 8(6): 819-831.
[10] Partha P DHAR, Abdul A AL-QARAWI, Mohammed A U MRIDHA. Arbuscular mycorrhizal fungal association in Asteraceae plants growing in the arid lands of Saudi Arabia[J]. Journal of Arid Land, 2015, 7(5): 676-686.
[11] Tahereh RAIESI, Alireza HOSSEINPUR, Hamideh RAIESI. Influence of bean rhizosphere on the biological properties and phosphorus fractionation in the calcareous soils amended with municipal sewage sludge[J]. Journal of Arid Land, 2015, 7(5): 644-652.
[12] XU Ligang, ZHOU Hongfei, DU Li, YAO Haijiao, WANG Huaibo. Precipitation trends and variability from 1950 to 2000 in arid lands of Central Asia[J]. Journal of Arid Land, 2015, 7(4): 514-526.
[13] QiQiang GUO, WenHui ZHANG, HuiE LI. Comparison of photosynthesis and antioxidative protection in Sophora moorcroftiana and Caragana maximovicziana under water stress[J]. Journal of Arid Land, 2014, 6(5): 637-645.
[14] Mohammad Rahim FOROUZEH, Mohsen SHARAFATMANDRAD. The effect of water spreading system on the functionality of rangeland ecosystems[J]. Journal of Arid Land, 2012, 4(3): 292-299.
[15] YanLi ZHUANG, Sophia RATCLIFFE. Relationship between dew presence and Bassia dasyphylla plant growth[J]. Journal of Arid Land, 2012, 4(1): 11-18.